What Is Based Answers and News

What Is Based Questions and Answers

Open Question: Will the fair & balance Fox News report that Sen. Kyl now says he was taken out of context?

Republican standard operating procedure "blame the media" Sen. Kyl said President Obama personally told him the administration will not support stricter border enforcement until Republicans back broad immigration reform. Now Kyl is saying that's not what he meant.Sen. Kyl now says says he was taken out of context and that he was referring to was the Left, "the president's base," and not the administration.http://corner.nationalreview.com/post/?q=OWZlZDA3ODhmNDkyYWY3NGRkODNjOTJkMjM5MzVhN2M= more

Open Question: what exactly is a f-buddy relationship?

one of my guy friends is sexually active hardcore. and in the past, he's told me that he's had relationships which were solely based on sex. and currently, he has been bringing around this girl (germ bag!) and i know they constantly have sex. but i know he's most likely having sex with other girls as well (yes, he's that kind of guy). so, clarification please? if you regularly have sex with someone all the time--does it mean you two like each other?? what exactly goes down in these relationships generally--do you just call the person and be like "hey wanna f? meet me at my place" or what!?! and do you think feelings are generally attached in these relationships as well--i don't see how they couldn't be! more

Open Question: In the following, if the parenthesis base was replaced by guanine, what would happen to the mRNA and the?

resulting amino acid sequence? TAC(T)TTTGGACGGAGGCGTCGTTTTGTGCCTGCTTCACATTA more

Open Question: What have I done do you think this can be forgotten especially by my other half?

I am a moderator on an internet forum based on a television programme and back in February a newcomer joined who showed a lot of interest in the programme at one point I offered to make a dvd for him on a documentary which he wanted, I kept saying it would be soon, or next week, or the week after but never sent it out to him. We had a falling out a few months back I decided to add him to my twitter account last week. Away from the forum he can see how saucy I am theres a programme we both watch and I have admitted to liking this guy in this programme to the point of doing something quite adult and I have said a few things to the guy I promised the dvd to in response and how good I am at this certain skill last night I got a bit drunk and we were talking about things on msn and now I realise I told him what my technique was and how I "OWN" at this kind of thing and said to him in confidence how I would do whatever it would take to get to the top by doing this act. IF he has saved our msn convo then I hope he doesnt use it against me in anyway at all I told him the other day I would sort out the dvd for him he seems to believe that I am also being targeted by online bullies who know where I live but its nice to see that hes caring. more

Open Question: What have I done do you think this can be forgotten?

Open Question: Where are 15y(army) MOS locations?

I'm bound for BCT/AIT soon, and im trying to find out where I may be stationed after graduation. I'll be working on Apaches. What bases could I possibly be going to? more

Open Question: What should I title my novel?

It's about these kids who go to this hotel. It's a ghost/murder story, based around a haunted room/hotel. It sounds cheesy but there's a lot more too it; I just don't want to go into detail. I was thinking of calling it either: 313 (which is the name of the haunted room) The John Carter Inn (which is the name of the haunted hotel) Burial Hill (which is the hill the hotel is built on) Which one is the best out of those three and why? Any other suggestions? Thanks. :)Well it's basically about these kids who go to this hotel on a class trip. They have to spend the night there and creepy stuff happens - people die. It's a horror book based around friendship and who you can and can't trust. It's message is that everyone is the enemy. more

Open Question: Can someone explain to me why the bible is often considered itself enough evidence for the existence of God?

Basically, I am an atheist who was raised as a Christian. I de-converted (if that is the correct terminology) due to the fact that I simply cannot accept the existence of God without enough evidence. I know that many people accept Christ (and other religions too) simply because they were told so and hold the bible (and other holy books) as complete and utter proof of it. To me, this never made any sense to me at all, as basing such an incredibly unlikely story such as the Christianity story on the idea that a single book says it is true just seems illogical. My question is, why do so many people use the bible as the end all/be all guide to the supernatural, and if it isn't the sole reason to believe the story it tells, what other evidence do you (or others) have that compels them to have faith? more

Open Question: How do they check Muslims in airplanes?

I'm going on an airplane, and i was wondering how they check Muslims, i know they are very strict after 9/11, and please don't argue, because i think it's unfair of how they stereotype ALL Muslims, based on one bad persons action, anyways, Do they bring Muslims into a separate room, and if they do, what do they do? -Thanks in Advance more

Open Question: Are Speeding Ticket fines too high. Deterant or oppression?

I agree there needs to be regulation. I agree that speed kills. I have not had a speed ticket for over a decade, and only 2 since the 1970's. I support law enforcement and understand the Legislature and/or courts of each state determine fines. I have a very fast car! My question is, are these fines too harsh compared to what would compel you to not speed. Should it be different in areas with little population/traffic. Some countries base the fine on a percentage of income, is this concept fair?Wow, bonus answer below to the question: How do you get to level 6 with 5% "Best Answers". more

Open Question: POLL - who do you think is prettier?

of these three photos, which girl do you think is prettiest? and who would you date (based off looks)? (they might be different) i'm trying to find out what society (or the society that lingers around polls on yahoo) find the most appealing in terms of beauty. http://i793.photobucket.com/albums/yy212/ferosh/kathleen.jpg http://i793.photobucket.com/albums/yy212/ferosh/grace.jpg http://i793.photobucket.com/albums/yy212/ferosh/28259_397239724022_719184022_431233.jpg thanks XD more

Open Question: Self Esteem/ Confidence help!?

I find that the reason i have low confidence is mainly because of anxiety i get. Because of my lack on confidence i find i get high anxiety when in social situations. I'll give an example, even after two years on my uni course, whenever i turn up to a lecture just walking into the room i get high anxiety and feel nervous of the lecturer might ask me a question, we might have to do presentations in the lecture etc I find the reason i'm not confident is more based on how my body acts in these sitations. Anixiety not because i think i'll say somethig stupid, but i cant help but talk nervously (the sound of my voiuce shaking etc). When i'm nervous like most people i know, my voice goes very dry, and i speak quietly and nerviously. This is what makes me shy because i know when i speak it'll come out all nervous sounding. I know if i could appear to be confident through my voice i would be fine in talking in these situtaions even if inside i am still really nervous. The only way i can do this is when i drink, i know i will sound relaxed and calm, so i am chatty and socialable even sometimes when i only drink a sip - so its more of a placabo effect somtimes (so its obviously my mental thinking i need to change) My question is minus alcohol what ways can you appear/sound confident even if you aren' on the inside. I mean people can tell i'm nervous, but some people say there were really nervious and shaky during a talk, but physcially it doesnt show.... so how can i try to do the same/. I am aware that the best method would be to overcome the actual problem of why i'm not confident etc. But ignoring that what ways like changing mental attitudes, general social tips, taking anything legally etc more

Open Question: Do you think PCs will replace Consoles?

Do you think there is any future for "consoles?" The only future I see is novelty. I mean, I'll always love the idea of plugging in an ancient system just for fun. But that aside, there doesn't really seem to be much reason for having consoles. Consoles are already starting to mimic PCs. They play movies, have internet, blah blah.. In the end I'd rather just have a good PC, where I can do all those things and then some. One big thing I thnk PCs have over consoles it that they extend beyond entertainment. On the PC, you can actually develop tools (or use them), meaning that theoretically you could do almost anything. In time most consoles can be emulated by PCs. What do consoles have over PCs? Really? Computers are expandable and they can be adapted to a lot of things. In fact, consoles are really just limited computers (with good graphic engines and hardware). I personally think the future is going to be Sky computing. I really hate the idea of everything I do being based somewhere else, but that might happen. What would be great is if you could have one central PC in a home, super powerful, that can be connected to your TV or anywhere else and hold all the functions in one. more

Open Question: Math Question!!!! Please Help!!!! 10 Points!!!!!!!!!!!!!!!?

A square pyramid has a total surface area of eight hundred square feet. The area of the base is two hundred square feet. What is the area of one triangular face of the lateral surface? one hundred square feet one hundred fifty square feet two hundred square feet two hundred fifty square feet AND What is the volume of the prism? A triangular prism is shown. The triangular base has a base of six yards and a height of five yards. The height of the prism is twelve yards. one hundred twenty cubic yards one hundred eighty cubic yards two hundred sixteen cubic yards three hundred sixty cubic yards more

Open Question: Relationship bases!?!?!?!?!?!?!?!?

Just wondering what are the relationship bases?? I don't really know them... more

Open Question: Why can i not sign into my msn?

Ok iv'e been signing on msn on my Blackberry for a month now. And during that time, i never signed in on my computer. But now just a week ago i tried signing in on my computer, and it wouldn't work. When i try to sign in this message pops up and say's " You're machine appears to have an invalid IP adress". So what can i do to fix this? Also when i sign in on my web based messenger, like msn.com, i can sign in always. It's just not on my messenger thing. Could the reason be that i hadn't signed into my msn on my computer for a month or something? But i did on my phone and on the web based messenger. Should i try uninstalling msn messenger and install it again? more

Open Question: ROTC: Can I choose what to do after I enter the service?

Well, I have a pilot's license and I am considering an aeronautics degree as well as a minor in airport management. On top of that, I'm applying for the USAFROTC scholarship. I'm a little afraid that I would be commissioned as a pilot without choice based on my know-how, where I would have to serve ten years before leaving. I really want to serve the minimum four years with an honorable discharge, find a job, and start a family. Can I choose?Oh, and I don't plan on becoming a pilot for my future career. more

Open Question: What is the best match (zodiac and birth order wise) for a youngest of the family, pieces girl?

I would like to know the guy I would be most compatible with based on what is his birth order in the family and zodiac sign. I am the youngest of 4 girls and was born march 17. more

Open Question: Is it moral to eat the flesh of another human to survive like in the movie Alive?

For those of you who have seen the movie, is it fictional, or are certain elements based on a real story? What happens to the two guys in the end who try to breach the Andes Mountains; do they live? Thanks. more

Open Question: What should I do??? help?

My father is putting a GPS system in my car when I get my license in about 3 weeks. He listed all my friends that he knows and only said that I can hangout with 2 of them. The 2 of my friends I hardly even talk to anymore. It's not like he doesn't know them. My dad says he doesn't want me hanging out with black people and Muslims and I think that it's just unfair to judge someones personality based on their race or religion. He said he hated muslims and I said "Well maybe, Muslims hate you" and he thinks im defending Islam now. It's gotten out of control.flyingmuscian, my father is obviously wrong. You're probably just as racist as him you skinhead. I think it's idiotic that I have to respect someone because society tells me to. Father or not it is wrong and so are you. more

Open Question: In some way or the other its always WE who are responsible for whatever that happens to us?

Even if others are responsible and even if its no fault of ours I mean, we always say and cite others as a reason for our mis-happenings but its still we who allowed them to be that reason even though we may be valid in holding them as culprits,even though its totally not our fault When others do something to us and even if we are right and they are wrong, its still we who allowed them to do whatever they did to us. For the moment I'm not saying that you have to be careful with people,not trust them at all and blame everything onto ourselves allowing people to get away,just saying accept whatever that comes to us as our own making ,in that way, you wont have regrets as whatever that happened to you was because of your decisions and you hold responsibility for it,also it reduces the level of hatred we are bound to have on others. You dont have to think "Oh,its because of him my life is in total jeopardy", instead you can think "Whatever it was, I allowed that person to make it this way,it was my decision,but it was based on what I felt at that moment and it was quite justified in doing that ,so lets have no regrets " That forgives myself as well as the person in question What do you think? more

Open Question: Have anyone seen the new Rush documentary?

It's called Rush: Beyond the Lighted Stage and it's supposed to be pretty great (based on what little I've heard about it). I just wanted to hear from any Rush fans that might have seen it.Moody, you have problems.Thanks for the info, folks. I've already got the DVR set to record tonight. more

Open Question: What would u do? 10 points for good answers?

Okay so I been working at a camp counselor at the beginning of the summer. Its a christian camp and the owner who owns it is a really STRONG christian based camp so everyone is kinda ehh crazy. But I am a christian myself anyways, I went to stay with my bf for a night because my parents were gonna be gone and they said, I can go spend fathers day with his family since I am apart of there family and I wrote on my FB that i missed my bf when i returned to camp and that I wanted to be with him still my boss got all worked up. And then he said, that becaus I got sun burned that he doesnt think i can handle the heat as well as I got reall sick from the heat because I didnt drink enough water he says that im not commited when I am commited I put up with how much pain I was in except they told me to go rest when I said, id work they told me to. So i did. I told them i was willing to work but they insisted i go sleep. I was like okay!! Severel people got dyhydgrated and sick and sunburned so why am I only one who gets yelled at. I get yelled at about everything. I watch Twilight and my bosses wife got soo MAD she yelled at me saying im a sin to god. o.O I watch scary movies and she doesnt know it. I mean hello its no ones buisness what I said, about my bf or what I watch what do i do? UGH!!! my bosses wife grabbed my wrist and said, that I didnt know how to bridle a horse when I knew how LOL!! she asumed i didnt because the bridle that i tried putting on another horse was all tangled up and got all twistted and i didnt want to work with it when i had to mount up on the horse i was riding to go on a trail rid e with my group so she grabbed my wrist an showd me what i was doing wrong even though i wasn't i laughed but i CRIED they make me cry even the employees i work with cryI cant leave. Its something I always wanted to do. I am geting the experience I need before going to work in a day care I need at least experience in a child facility and thats gonna look good on my resume. more

Open Question: What do you guys think of the cast of Avatar the Last Airbender movie being mainly white, and indian?

Okay, so please tell me what you guys think? The show is obviously asian. On the show, they have chinease culture, and writing. I read the description of the show, and it said based on chinease culture. Even the director, and producer said it was asian. So what do you think of there only being 3 asians in the movie, but as background actors? But Zuko, Ozai, and Azula are indian, but Katara, Sokka, and Aang are white. This would've been a good chance for asians to be on the big screen of a good movie. But I don't think it will be so good. Plus Zuko barely has a scar. What do you guys think?? more

Open Question: My cat has CRF. Kidneys are going down hill...Is she in the last stages or the beginning?

I took my cat to the vet and had blood work done, the blood work showed that her kindeys werent functioning properly. Here are her symptoms, I just want to know what stage she is in based on her symptoms... Refusal to eat all food (dry food and prescription wet food) drinks a little bit of water here and there lethargy (no energy at all) Looks Dazed or out of it Does not move much at all But NO vomitting so far... How bad is she? more

Open Question: What is the ranking of cars based on prestige?

Like how do cars rank? Ex. Ferrari > BMW > Honda > Ford more

Open Question: Anyone hate the radical feminists (aka the Femi-nazis) as much as I do?

Don't get me wrong, I used to call myself a feminist as I support gender equality, reproductive rights, and ending gender-based violence. But I later came to learn that radical feminists have turned feminism into nothing more than male oppression. I now call myself an equalist. I stopped calling myself a feminist after I met my future husband. He had a girlfriend who later became a junkie who he broke up with because of her abuse of alcohol and drugs. He later came to find out he had gotten her pregnant. She decided she was going to give the baby up for adoption and not have him sign the birth certificate. I always thought at the moment of birth a man had parental rights but boy was I wrong. It turns out that if he didn't sign Punitive Fathers Registry within thirty days of the birth of his child his parental rights would be completely relinquished and she could give his baby, who he layed down & conceived and gave 23 chromosomes to, up for adoption. And of course she claimed it wasn't his and they had to have a court-ordered paternity test that proved he was the father. In the end SHE relinquished her parental rights and he become the sole legal parent of his child before I adopted the child two years after me and my husband met (right after we were married). Then the whole Tebow Superbowl ad thing the radicals freaked out about only showed they were not pro-choice but pro-abortion. I'm STRONGLY pro-choice, so I had no problem with Ms. Tebow talking about keeping her baby. If she was calling abortion murder and saying it's the wrong choice I'd be like "okay, this ad shouldn't be aired during the Superbowl" BUT it didn't do that! I had no problem with the ad. When watching the Superbowl I honestly didn't even know it was was the alleged "anti-abortion ad" until at the end of the ad Ms. Tebow called her son "Timmy." What made me write this was I got into a debate online with a self-proclaimed radical feminist who said certain sexual positions, like missionary, were exploitative to women because the man is on top! But has had zero problem with a woman riding her man. She also said she would never have sex with a man or get married because they are forms of patriarchy and consensual sex between men and women is the same as rape - which makes 0 sense. She had a link to this blog of another self-proclaimed radical feminist who argues that becoming a lesbian is essential to destroying patriarchy, saying "'I think lesbianism is a very powerful and immediate solution to male supremacy and violence. Women-loving women, women-touching women are the ultimate anti-thesis to this woman-hating world".Stealth: Here's the blog of the insanefeminazi: http://allecto.wordpress.com/Logan: That's why I said radical feminists, child. Also, I have one biological child of his and another on the way. I adopted his first-born child. She become a junkie whilst they were dating which is why they broke up. I'm not saying hate the woman, I'm syang hate the radicals who took away a man's right to be a father. more

Open Question: what was the game based on before red dead redemption?

Open Question: Is it possible to set up a limit order that depends on movement in another stock?

So, let's say a sell order for 100 shares of XYZ stock that is executed if but only if ABC stock hits $35.00. The trigger for the sale of the XYZ stock is a price limit in a totally different stock (ABC). I just want to know if such an arrangement is possible, and if so what is it called? It's what program trading computers do all the time -- contingent stock trades based on exogenous data from other stocks. I don't happen to own or control a program trading computer because I am not Goldman Sachs. But I still would love to be able to do trades in one stock based on price levels in another. Can you help me? more

Open Question: Review my book Preview?

Please read carefully and answer the questions below. Title: Seeds of Veridis Genera: Fantasy / Action Adventure "Seeds of Veridis" takes place in a world know as Verus Terra which promotes a general appeal of medieval romanticism paired with the farthest reaches of one’s imagination. Verus Terra has been torn by relentless turf wars of its two great superpowers; the alliance of Gramonomyth and the kingdom of Laluora. After a bloody 11 year stalemate the king of Laluora (King Mathis) miraculously discovers a method to weaponize various plants species. This new bio weapon shatters the Gramonomyth front and drives them back to defensive positions. However, soon after this is accomplished the Kingdome of Laluora is stricken by a mysterious famine. The soil becomes oddly unfertile, crops fail, and the once feared plant weapons of Laluora are now suddenly rendered useless. Laluorian society degrades and becomes riddled with civil strife. King Mathis becomes desperate and in his desperation he turns to the ancient myths and legends of Verus Terra hoping to uncover a secret power. Little is known about what King Mathis finds. However, what is known is that individuals with a rare type of green eyes are being abducted by agents of the crown seemingly vanishing forever only to be assumed as dead. Mathis names these green eyed individuals as Druiths, his agents seek them with vigor and often with deadly force. This story follows the journey of a wanderer named Vaydric, a Druith. Ever since Vaydric was a child he has always had an intimate connection to the natural world and even gained miraculous abilities to influence plant matter. However Vaydric will soon find that his gifts run deeper than he thinks. Vaydric becomes forced into hiding when Agents of the crown kill his family along with the majority of his town. These events become branded in Vaydirc’s mind and he has grown vengeful towards Laluorian authority. A number of years pass until Vaydric reunites with an old friend; their meeting triggers a series of escalading events that sends him on a journey to discover what and who he really is. Vaydric is forced to put his trust in a number of unorthodox companions to protect that which he loves and uncover truth shrouded in mystery. Through his journeys Vaydric realizes that everything is interconnected; the famine, the Druiths, and a long forgotten legend all play a part in the destruction or salvation of Verus Terra. The more Vaydric discovers the more he realizes that he alone has the power to save this world. The illusions from myth to truth shall be bridged, the line between friend and foe will be bent, and the very fabric of life and love will be tested in "Seeds of Veridis". #1) On a scale of 1 - 10 (1 being a low or bad rateing and 10 being a excellent rateting) Please rate how interesting or original this story sounds to you? #2) If you you have used or have ever baught an e-book before (based on this preview) would you consider buying and e-book version of this story. #3) General comments or statments of the book/preview. Thanks, your imput is greatly appreciated ! more

Open Question: What was Bob Horner's uniform number?

Does anyone know what number Bob Horner wore when he played third base for the Atlanta Braves? I checked over a dozen baseball sites, and couldn't find it. more

Open Question: "evolution is as true as 2+2=4" (Tis a bit long, friends)?

Your thoughts on this abstract? On CNN's Lou Dobbs program, discussing the difference between evolution, intelligent design, and creation were well- known ID spokesmen, Dr. Jon Wells, and famous evolutionist, Dr. Michael Ruse. In the middle of the discussion, Dr. Ruse claimed that evolution is a proven fact, just as "proven" as 2+2=4. When challenged, he insisted the two statements are equivalently true. Is this so? If not, what is the difference? Here's a simple experiment to verify one of the statements. Extend two fingers on your left hand, and then extend two on your right hand. Lay them all on the table in front of you, and count them. You should get four. If you are careful, every time you count them, you will get four. It's an observational fact. Now devise an experiment to verify evolution. Keep trying. There must be one. I suspect even Dr. Ruse would be unable to propose an experiment to verify evolution like we verified our mathematical equation. Even if both statements are facts, obviously they are not the same kind of facts. That's because evolution is not something we can observe. If it's happening today, it's going too slow to observe. If it happened in the past, we can't return to the past to see. It may be a fact of history, but how would we know? Certainly not in the same way we know 2+2=4. Evolution, at the most, is an idea about history, not observational science. There may be inferences we can make about the past based on modern observations, and these may or may not be true, but don't bother claiming that ideas about history are the same as repeatable observations in the present. And don't insult us by thinking that we will believe that they are. It makes you wonder if evolutionists really believe what they say or if they are purposively trying to mislead. I suspect there are some of both. Many evolutionists I have met have something in their own past that has turned them away from "religion." Maybe it was legalistic parents or abuse by a respected figure. Maybe it was the insistence that we should "avoid science because it contradicts the Bible," leaving them without answers to historical claims made in the name of science. A bitter hatred of God and Biblical truth developed, leading them to a life dedicated to freeing others from the shackles of Scripture, justifying the wrong use of evolutionary claims. However, most evolutionists are evolutionists because they are victims of the wrong teaching of others. Naturalism (i.e., naturalistic evolution) is often desirable, for it seemingly frees us from the authority of a Creator God. Without a God to whom we are accountable, we are free to live as we choose. College students, often surrounded by hedonism are particularly ripe for wrong thinking, and many never recover. Either way, it can lead to ludicrous statements, such as "evolution is as true as 2+2=4." Thankfully, most people are not hopelessly deceived. Polls in America show that the majority believes in creation, and many more want it taught. Less than 10% are confirmed evolutionists, yet they seemingly control education. They may teach that evolution is well proven, but we don't have to believe them.Actually "monkey"...Evolution is debated among scientists that say its FACT and scientists that say its THEORY...and dont tell me fact and theory are the same...cuz theyre actually not. Oh, and if you read the very first line you should know I didnt type this."Youre making yourself sound very ignorant".....PThh-ahahahahahahahaaa!!! Oh, ok. Thanks wise old owl...Glad you cleared up the whole thing for me. You should get a nobel peace prize.@Craig EXACTLY...Finally someone here understands that there is a difference btwn micro and macro.Big Red...again...your rant is still within the confines of micro evolutionSheesh.... more

Open Question: how do i get battlefield 2 complete collection to work right?

ok so the base version and special forces works fine but armoured fury and euro force doesnt work, even though i entered the code, it says my browser does not support it, what does that mean? also, the multiplayer wont work, i installed the patch v1.50, but it still says that my version is older than the server, WHAT DO I DO?!?!?!?!?!? more

Open Question: Anyone hatte radical feminists as much as I do (AKA feminazis)?

Don't get me wrong, I used to call myself a feminist as I support gender equality, reproductive rights, and ending gender-based violence. But I later came to learn that radical feminists have turned feminism into nothing more than male oppression. I know call myself an equalist. I stopped calling myself a feminist after I met my future husband. He had a girlfriend who later became junkie who he broke up with because of her abuse of alcohol and drugs. He later came to find out he had gotten her pregnant. She decided she was going to give the baby up for adoption and not have him sign the birth certificate. I always thought at the moment of birth a man had parental rights but boy was I wrong. It turns out that if he didn't sign Punitive Fathers Registry within thirty days of the birth of his child his parental rights would be completely relinquished and she could give his baby, who he layed down & conceived and gave 23 chromosomes to, up for adoption. And of course she claimed it wasn't his and they had to have a court-ordered paternity test that proved he was the father. In the end SHE relinquished her parental rights and he become the sole legal parent of his child before I adopted the child two years after me and my husband met (right after we were married). Then the whole Tebow Superbowl ad thing the radicals freaked out about only showed they were not pro-choice but pro-abortion. I'm STRONGLY pro-choice, so I had no problem with Ms. Tebow talking about keeping her baby. If she was calling abortion murder and saying it's the wrong choice I'd be like "okay, this ad shouldn't be aired during the Superbowl" BUT it didn't do that! I had no problem with the ad. When watching the Superbowl I honestly didn't even know it was was the alleged "anti-abortion ad" until at the end of the ad Ms. Tebow called her son "Timmy." What made me write this was I got into a debate online with a self-proclaimed radical feminist who said certain sexual positions, like missionary, were exploitative to women because the man is on top! But has had zero problem with a woman riding her man. She also said she would never have sex with a man or get married because they are forms of patriarchy. She had a link to this blog of another self-proclaimed radical feminist who argues that becoming a lesbian is essential to destroying patriarchy, saying "'I think lesbianism is a very powerful and immediate solution to male supremacy and violence. Women-loving women, women-touching women are the ultimate anti-thesis to this woman-hating world".*hate, Excuse me. more

Open Question: Why is Liberalism is a Mental Disorder?

There was a lady invited to UC Berkely about 7-8 years ago for a Liberal art class. She was to get on stage a perform, and the class was to take a test based on what they thought of the performance. Basically, she got up on stage with a bucket of feces and smeared it all over her body. She proceeded to dance around on stage like a Go Go Dancer, then she started masturbating. A couple of the Liberals in class were appalled, but most seemed to enjoy it, and rated her favorably, and in turn were scored favorably by the professor. Those who did not rate the mental illness favorably, were scored poorly by the professor. A couple of "sane" faculty out of the majority of "insane" faculty questioned the judgment of the insane Liberal arts professor. His answer was, "she was just expressing herself". With that said, Liberalism is a Mental Disorder. more

Open Question: Remix of the Marjaani song?

Need to know what is the song in the link: http://www.youtube.com/watch?v=og-8LjNNeoM I know it is based on the Marjaani song by Billu Barber. I hear some english phrases like Shake Ya body now :D.. Can someone unveil this for me,which is this song,that ''Shakiro'' is dancing to? more

Open Question: How to tell if girlfriend/boyfriend is good or bad?

I'm curious. One of my brothers just broke up with his girlfriend today. He claims she had mental issues, was f'd up in the head. He also claims that with his ex gf's people would tell him to take care of her, they picked out the good qualities and that with his last one that he didn't get one piece of good about her. Myself, I went to school with that girl and I was not happy when I found out they were dating. I can tell she was bad based on 1) she's sexually active (she's only 20 and slept with over a dousin guys), 2) she was a bully, especially to anyone younger than her (also rode school bus with her to school), and 3) seemed to be in love and not over other guys. In out last yr of school she had a bf she claimed she was going to marry, but yet she still had feeling for her best friends bf. Now my brother also tells me she had feelings for this other guy I never heard of too. She also cheated on other bf's. Then, another brother of mine had a gf who I like very much. She is social, nice, modest, not sexually active, etc. I don't have anything on boys though to determine quality as I am new to the bf thing and haven't spent much time around other peoples boyfriends. I have one sister but I never really got to know him when he was seeing my sister. So, what can you add? How to determine quality of bf or gf?Thank you askyourm... Lot's of good information. Will keep it all in mind. more

Open Question: Am I expecting too much of my boyfriend or time to move on..?

My bf is 24, I'm 21 and weve been together for over two years. I am becoming increasingly aggravated by what I feel is his immaturity and not moving forward into a more committed, mature relationship or at least talking about being together down the road. I want to draw a general consensus on the following question: Should I move on or cool down? Positives: 1. Love 2. Always happy to see me and initiates dates (so he's still interested) 3. Hardworking, loyal and we have a great connection Negatives 1. I'm moving out (due to ongoing issues between my family) and he said he doesn't want to move in because, "that's what people looking to get married do" (direct quote). 2. He has plans and future ideas but they do not include me (ie: vacations, his ideal living situation when he leaves his parents house). Basically, a "me" versus "we" mentality. 3. In general, selfish behaviors like not paying for lunch despite driving over to his parents house and not to mention in the process of paying for a new place to live. Based on this information, would it be wrong of me to think that he's too comfortable or is this a phase that I should lovingly, patiently wait for him to move out of his emotional inconsideration and nonavailability? Yes, I've made mention of some behaviors I didn't appreciate. more

Open Question: The crack in time in Doctor Who?

When the Doctor was put inside the Pandorica, all the villains said his Tardis was causing the cracks. Am I right in thinking that the voice that said "Silence will Fall" is making the Tardis create the cracks? Also what did they mean by "The base code for the universe - Amy's time" ? more

Open Question: I want to write a novel, but I don't know what is acceptable...help?

Do all "great" novels require a solid plot, or can some of them just be about the personality and mannerisms of a character... I want to write a novel, but I don't want it to be cliche and make the main character have a dilemma, and then at the end of the story he/she fixes the problem and BAM ...a lame, happy ending. Can someone give me advice on what is acceptable in writing a novel, based on the things I said above? more

Open Question: What PS1/PS2 2 player co-op rpg game is this?

Okay I really dont remember much. I know it was a realtime battle system (no turn based/final fantasy type) It was on I Believe. the ps2. However it might of been ps1. Anyways I know very little bits. But for sure, these things was in them: There was some type of "tree" enemy. Such as a ent. However may be called something else The second player couldn't join at the very beginning. Not until player one had a second party member in the "offline" Then the second player hit some buttons like start or something to join in as the second party member. I also said before but, the battle is not turn based like final fantasy. The screen was one screen (Similar to champions series, such as champions of norrath) It was actually VERY similar to that game (it wasnt the other champions game) I cant really say much more.. I been looking for this game about 3-4 years now. Giving up multiple times in the process.. I googled and founds lists of 2 player RPGs but never found anything that caught my eye that looked like the game. I also know that it is not baulders gate, dark alliance. It didn't have cartoony graphics, it was the graphics like Champions of norrath, once again being similar to it.So to sum it up its like this A ps2 or ps1 game Similar to champions of norrath Not the other champions game/baulders gate dark alliance Not cartoony graphics Realtime battle system (not like FF) Had some "ent" type creaute Second player could NOT join in the beginning, however once player 1 got a secondary party member doing the storyline, second player could join. Wasnt splitscreen, it was one screen and we couldn't leave itAlso a list of PS2 or PS1 2 player games would be welcomed. Thank you. more

Open Question: What is the best way to rehabilitate antisemites?

I asked previously, but I didn't find the arguments made very convincing. BMB (Girl) asserted: "Anti-semetism exists, but it's not a logical thing. So rehabilitation that might logically work, wouldn't help anything." Mental illnesses are almost by definition irrational behaviors and yet there are perfectly rational ways to treat most of them. I also don't know that I would agree that antisemitism is entirely illogical. If your only exposure to Jews and Jewish thought came through the writings of Shahak, Finkelstein, Kevin McDonald, Stormfront, heretical.com, Holocaust deniers and the rest, then it might be very difficult to see the truth. In fact, much of this literature is likely to make someone resistant to accepting truths staring them in the face. scaerdrys said: "You can't rehabilitate a bigot; whatever improvement they get will have to come from a personal re-evaluation of their ideologies." The same could be said for any belief, but clearly there are experiences that lead people to re-evaluate their thinking. Re-evaluation doesn't occur in a vacuum. What are those experiences? scaerdrys also said: "The notion that you can educate away bigotry is silly---it's an elitist notion that the educated can't be bigots when history proves otherwise." My feeling is that most hardcore antisemites are miseducated, not uneducated. This is one of the things that makes dealing with them so difficult. The uneducated bigot can be corrected by exposure. A rural southerner who just doesn't like blacks can meet a nice black family and realize that not all blacks exhibit the behaviors he associates with blacks. Serious antisemitism isn't based upon a few primitives like the idea that Jews are cheap or stingy. If it was, then it would be easy to correct and fairly harmless. While antisemites may be simple bigots, they are almost always more than that. Antisemitism presumes a dark and conspiratorial view of the world. The simple bigot isn't necessarily afraid of the people he hates, but the antisemite is genuinely afraid that something diabolical is occurring in the world. Nobody believes there is a vast international conspiracy by blacks, Hispanics, or Asians but many think Jews run the show. Antisemites typically share more in common with 9/11 truthers than they do with simple bigots. The question is what measures can you use to convince the antisemite--or any other conspiracy theorist--to rethink things.@Drake: That's besides the point. I don't support restrictions on speech in Europe and I did not support the imprisonment of David Irving in Austria. However, these restrictions arose for historical reasons (i.e. Nazi Germany). I think speech restrictions are counterproductive because they give ammo to those who believe in conspiratorial Jewish control of the world. more

Open Question: what is price of a 2006 highlander base?

47,153 miles 2006 toyota highlander base 3.3L 6cyl engine 4 door vin jteep21ao60141269 what is the price ! good price for it or book price for it????????????? help more

Open Question: What Steven Baldwin movie is this?

I don't remember much about the movie, but i do know that it was probably made in the 80s (based on the dancing) and set in the 50s (based on the black and white TVs). Steven was on a dance show, but that is eventually replaced by another show called "Psychedelic Shack." At one point, Steven's character has a dance-off with another man in his living room. That's all I've got. Thanks! more

Open Question: Does he love me back?

Okay, so this may sound stupid, but I'm in love with a guy who's 2 and a half years older then me. I think he likes me back, but I was just checking your guy's opinions first. So, here's what I can tell you :) He always say's he loves me on texts and stuff He puts about 20 x's on the end of each text Whenever I meet up with him it ends up us hugging each other and stuff. Yesterday i ended up falling asleep on him :) He always calls me gorgeous and beautiful Everyone asks if we go out He texts back sraight away usually That's about it. By the way, i'm 14 and he turned 17 yesterday and I don't care what you think about the age stuff, because most adults get married to people with about 2 years difference... so could you please help me out. Obviously I'm not going to base all this on what you think, but it would help me out a lot... also please no rude comments thanks :) xxEveryone just assumes that because I'm only 14, I'm immature, irresponsable and stupid. I don't want people to judge me because of my age or anything like that. You don't understand how much I've fallen for this guy. All I wanted was a guidance to wether he likes me, not a lecture on why I shouldn't go out with him. You can't control your feelings towards people, because if you could the world would be a much better place. Thanks everyone who's been supportive xx more

Open Question: So in the end there is only going to be one fan base standing...?

Who will it be... Everyone is saying that there team is going to win... Bashing everyone else and what not... But who do you think are the ones bashing more than everyone else...?BTW i think its Argentina fans.. more

Open Question: Did i eat somewhat healthy today? help?!?

- Breakfast - 330 calories ~ Fiber One Cereal 1c w Unsweetened Soymilk 1c ~Blueberries 1/2c ~FF Cottage Cheese 1/4c ~Grapes about 10 - Snack - 100 calories ~Rold Gold Pretzel Sticks 48 sticks 1 serving - Lunch - 350 calories ~ Chicken Salad Sandwich on High protein low calorie/carb bread ~ Spinach salad with 15 peanuts & 100 calorie pack of almonds - Snack - 100 calories ~Rold Gold Pretzel Sticks 48 pretzels 1 serving - Dinner - ???? Havent had dinner yet so im not sure what im having, but ill probably base it around 200 - 250 calories like i usually do. Had about 900 calories w/o dinner included, the only thing i let myself go today is pretzels but i dont eat candy or drink soda usually so i thought its not the worst thing to eat.trying to aim for around a 1200 calorie diet since its summer and i usually do nothing most the day. But i do go to the gym 3 - 5 times weekly for an hour and usually end up eating about 200 extra calories on those days more

Open Question: Knot in my leg? remedy?

Okay, so basing my pain from what people have said, i believe I have a knot in my leg. Its in the back of my leg in the crease of my leg and my butt. I've had this for a while now... my girlfriend has tried to massage it out but it never works. Some days it goes away but its there for the most part. What should I do? its really annoying and is partially painful. I've tried to stretch my leg but no luck. please help. more

Open Question: What language should I learn if I'm going into the Environmental & Land-based sector?

I'm fluent in english and arabic but i feel that i need another language seeing as i love learning new languages and it'll be good for my future career :D Thanks! more

Open Question: What anime was based on giant bugs taking over the world that was shown on adult swim?

What Is Based News

Herald, The; Glasgow (UK) - INVESTORS have wiped almost pound(s)100 million off the market

June 25, 2010 --

INVESTORS have wiped almost pound(s)100 million off the market value of Dana Petroleum after the company confirmed it had suffered a major... more

Herald, The; Glasgow (UK) - Trident policy ignores wishes of the public

June 25, 2010 --

In a Budget promising to cut billions from future welfare benefits and make reductions of up to 25% in some government departments, it is... more

Evening Post; Bristol (UK) - Herbert so proud of New Zealand braves

June 25, 2010 --

NEW ZEALAND 0 PARAGUAY 0 NEW Zealand coach Ricky Herbert felt his side bowed out of the World Cup with pride as, despite a goalless draw... more

Charleston Gazette, The - Oil well saga enters crucial phase

June 25, 2010 --

WASHINGTON - The saga of BP's runaway Deepwater Horizon well, already entering its third month, has entered a crucial phase that will... more

Charleston Gazette, The - READERS' Voice

June 25, 2010 --

* I found the cartoon of Jesus degrading and disgusting. Shame on your for printing it. n If the current status of the oil spill is an... more

Buffalo News - River of laughs

June 25, 2010 --

Apologies for the current critical cliche, but there's a genuinely jaw-dropping moment in the extraordinary and much- acclaimed documentary... more

Sentinel, The; Stoke-on-Trent (UK) - Herbert full of praise for departing All Whites

June 25, 2010 --

NEW Zealand coach Ricky Herbert felt his side bowed out of the World Cup with pride after a goalless draw against Paraguay saw them miss out... more

Bangor Daily News - Order given to design, price Bangor arena

June 25, 2010 --

BANGOR - City councilors on Thursday sent their newly hired architect and construction manager off with the task of designing and pricing a... more

Sun, The; San Bernardino, Calif. - Healthcare reform pushes hospitals to align with medical providers

June 25, 2010 --

The system is beginning to change.

Health care reform is driving new alliances between health care providers, hospitals and... more

Daily Post; Liverpool (UK) - Ricky's men prove to be more than just All White

June 25, 2010 --

Paraguay ......................... 0 New Zealand................... 0 NEW ZEALAND coach Ricky Herbert felt his side bowed out of the World... more

What is MLM Residual Income? - Can I Cash In?

Microcontroller | Microcontroller Projects | Microcontroller in Pakistan Lahore Multan

What is Microcontroller,Microcontroller,PIC 16f877,Microcontroller based Projects, Microcontroller in Pakitan,Microcontroller in Lahore, Microcontroller in Multan more

Fragment based drug design

Fragment based drug design, QSAR is a novel concept developed and implemented by VLife team more

What is a Pyramid Scheme? The Dirty Truth..

What Is Wenetprofits Home Based Business And How Does It Work?

More and more people prefer to work from home This business offers them the possibility to make money and spend more time next to their ... more

Brief Pyxism Review

Brief overview of an 'up and coming' newcomer to the world of online business. more

GRN Conference review, Global Resorts Network in Forida!

http://www.5figureweeks.com/ Charles Simpson reviews Mark Hoverson's Global Resorts Network Conference live from Florida. Find all your GRN info and free home based business tutorial videos here. more

6 Keys to Guaranteed Entrepreneur Success

http://www.YouWillBeShocked.com 6 Keys to Guaranteed Entrepreneur Success for Your Homebased Business Opportunity. From mindset to focus CEO Level Income in under 6 months. more

Blog review: Barriers to cloud based computing - institutionalized thinking

Data storage architect blogs about barriers to cloud based computing, this time institutionalized thinking. more

The Internet Business Blog

The Internet Business Blog more

Welcome to What Is Based

What Is Based Questions and Answers

Open Question: Will the fair & balance Fox News report that Sen. Kyl now says he was taken out of context?

Open Question: what exactly is a f-buddy relationship?

Open Question: In the following, if the parenthesis base was replaced by guanine, what would happen to the mRNA and the?

Open Question: What have I done do you think this can be forgotten especially by my other half?

Open Question: What have I done do you think this can be forgotten?

Open Question: Where are 15y(army) MOS locations?

Open Question: What should I title my novel?

Open Question: Can someone explain to me why the bible is often considered itself enough evidence for the existence of God?

Open Question: How do they check Muslims in airplanes?

Open Question: Are Speeding Ticket fines too high. Deterant or oppression?

Open Question: POLL - who do you think is prettier?

Open Question: Self Esteem/ Confidence help!?

Open Question: Do you think PCs will replace Consoles?

Open Question: Math Question!!!! Please Help!!!! 10 Points!!!!!!!!!!!!!!!?

Open Question: Relationship bases!?!?!?!?!?!?!?!?

Open Question: Why can i not sign into my msn?

Open Question: ROTC: Can I choose what to do after I enter the service?

Open Question: What is the best match (zodiac and birth order wise) for a youngest of the family, pieces girl?

Open Question: Is it moral to eat the flesh of another human to survive like in the movie Alive?

Open Question: What should I do??? help?

Open Question: In some way or the other its always WE who are responsible for whatever that happens to us?

Open Question: Have anyone seen the new Rush documentary?

Open Question: What would u do? 10 points for good answers?

Open Question: What do you guys think of the cast of Avatar the Last Airbender movie being mainly white, and indian?

Open Question: My cat has CRF. Kidneys are going down hill...Is she in the last stages or the beginning?

Open Question: What is the ranking of cars based on prestige?

Open Question: Anyone hate the *radical* feminists (aka the Femi-nazis) as much as I do?

Open Question: what was the game based on before red dead redemption?

Open Question: Is it possible to set up a limit order that depends on movement in another stock?

Open Question: Review my book Preview?

Open Question: What was Bob Horner's uniform number?

Open Question: "evolution is as true as 2+2=4" (Tis a bit long, friends)?

Open Question: how do i get battlefield 2 complete collection to work right?

Open Question: Anyone hatte radical feminists as much as I do (AKA feminazis)?

Open Question: Why is Liberalism is a Mental Disorder?

Open Question: Remix of the Marjaani song?

Open Question: How to tell if girlfriend/boyfriend is good or bad?

Open Question: Am I expecting too much of my boyfriend or time to move on..?

Open Question: The crack in time in Doctor Who?

Open Question: I want to write a novel, but I don't know what is acceptable...help?

Open Question: What PS1/PS2 2 player co-op rpg game is this?

Open Question: What is the best way to rehabilitate antisemites?

Open Question: what is price of a 2006 highlander base?

Open Question: What Steven Baldwin movie is this?

Open Question: Does he love me back?

Open Question: So in the end there is only going to be one fan base standing...?

Open Question: Did i eat somewhat healthy today? help?!?

Open Question: Knot in my leg? remedy?

Open Question: What language should I learn if I'm going into the Environmental & Land-based sector?

Open Question: What anime was based on giant bugs taking over the world that was shown on adult swim?

What Is Based News

What Is Based Links

Herald, The; Glasgow (UK) - INVESTORS have wiped almost pound(s)100 million off the market

Herald, The; Glasgow (UK) - Trident policy ignores wishes of the public

Evening Post; Bristol (UK) - Herbert so proud of New Zealand braves

Charleston Gazette, The - Oil well saga enters crucial phase

Charleston Gazette, The - READERS' Voice

Buffalo News - River of laughs

Sentinel, The; Stoke-on-Trent (UK) - Herbert full of praise for departing All Whites

Bangor Daily News - Order given to design, price Bangor arena

Sun, The; San Bernardino, Calif. - Healthcare reform pushes hospitals to align with medical providers

Daily Post; Liverpool (UK) - Ricky's men prove to be more than just All White

What is MLM Residual Income? - Can I Cash In?

Microcontroller | Microcontroller Projects | Microcontroller in Pakistan Lahore Multan

Fragment based drug design

What is a Pyramid Scheme? The Dirty Truth..

What Is Wenetprofits Home Based Business And How Does It Work?

Brief Pyxism Review

GRN Conference review, Global Resorts Network in Forida!

6 Keys to Guaranteed Entrepreneur Success

Blog review: Barriers to cloud based computing - institutionalized thinking

The Internet Business Blog

What Is Your Love Based On?

Problem-Based Learning Faculty Institute - What is PBL?

What is value-based management?

WikiAnswers - What is paper-based communication

WikiAnswers - What is screen-based communication

What is experience-based learning?

Open Question: Anyone hate the radical feminists (aka the Femi-nazis) as much as I do?